Manipulating Characters

Many functions enable to manipulate characters. Here only a few are presented. To illustrate their utility, DNA sequences will be manipulated.

> simpleDNASeq <- "AACATGACAGTTAGGACAGATACAATAATATATACAGAGACAGACAGACAGATTATATAC"
>
> ## Separate the characters wih the function strsplit
> simpleDNASeq_vec <- unlist(strsplit(simpleDNASeq,""))

Exercise 14:

Using the simpleDNASeq character string:

• Find the indexes of 'A' with grep.
• Try the same command with grepl and see what it does.
• Find a submotif 'AA' with the gregexpr command.
• Replace the first occurrence of "A" by "C" with sub.
• Replace all occurrences of "A" by "C" with gsub.
• Extract nucleotides from position 4 to 8 with substr.
• Concatenate two sequences with paste. Look at ?paste0 and replace the previous command with it.